1 | n/a | |
---|
2 | n/a | # Various microbenchmarks comparing unicode and byte string performance |
---|
3 | n/a | # Please keep this file both 2.x and 3.x compatible! |
---|
4 | n/a | |
---|
5 | n/a | import timeit |
---|
6 | n/a | import itertools |
---|
7 | n/a | import operator |
---|
8 | n/a | import re |
---|
9 | n/a | import sys |
---|
10 | n/a | import datetime |
---|
11 | n/a | import optparse |
---|
12 | n/a | |
---|
13 | n/a | VERSION = '2.0' |
---|
14 | n/a | |
---|
15 | n/a | def p(*args): |
---|
16 | n/a | sys.stdout.write(' '.join(str(s) for s in args) + '\n') |
---|
17 | n/a | |
---|
18 | n/a | if sys.version_info >= (3,): |
---|
19 | n/a | BYTES = bytes_from_str = lambda x: x.encode('ascii') |
---|
20 | n/a | UNICODE = unicode_from_str = lambda x: x |
---|
21 | n/a | else: |
---|
22 | n/a | BYTES = bytes_from_str = lambda x: x |
---|
23 | n/a | UNICODE = unicode_from_str = lambda x: x.decode('ascii') |
---|
24 | n/a | |
---|
25 | n/a | class UnsupportedType(TypeError): |
---|
26 | n/a | pass |
---|
27 | n/a | |
---|
28 | n/a | |
---|
29 | n/a | p('stringbench v%s' % VERSION) |
---|
30 | n/a | p(sys.version) |
---|
31 | n/a | p(datetime.datetime.now()) |
---|
32 | n/a | |
---|
33 | n/a | REPEAT = 1 |
---|
34 | n/a | REPEAT = 3 |
---|
35 | n/a | #REPEAT = 7 |
---|
36 | n/a | |
---|
37 | n/a | if __name__ != "__main__": |
---|
38 | n/a | raise SystemExit("Must run as main program") |
---|
39 | n/a | |
---|
40 | n/a | parser = optparse.OptionParser() |
---|
41 | n/a | parser.add_option("-R", "--skip-re", dest="skip_re", |
---|
42 | n/a | action="store_true", |
---|
43 | n/a | help="skip regular expression tests") |
---|
44 | n/a | parser.add_option("-8", "--8-bit", dest="bytes_only", |
---|
45 | n/a | action="store_true", |
---|
46 | n/a | help="only do 8-bit string benchmarks") |
---|
47 | n/a | parser.add_option("-u", "--unicode", dest="unicode_only", |
---|
48 | n/a | action="store_true", |
---|
49 | n/a | help="only do Unicode string benchmarks") |
---|
50 | n/a | |
---|
51 | n/a | |
---|
52 | n/a | _RANGE_1000 = list(range(1000)) |
---|
53 | n/a | _RANGE_100 = list(range(100)) |
---|
54 | n/a | _RANGE_10 = list(range(10)) |
---|
55 | n/a | |
---|
56 | n/a | dups = {} |
---|
57 | n/a | def bench(s, group, repeat_count): |
---|
58 | n/a | def blah(f): |
---|
59 | n/a | if f.__name__ in dups: |
---|
60 | n/a | raise AssertionError("Multiple functions with same name: %r" % |
---|
61 | n/a | (f.__name__,)) |
---|
62 | n/a | dups[f.__name__] = 1 |
---|
63 | n/a | f.comment = s |
---|
64 | n/a | f.is_bench = True |
---|
65 | n/a | f.group = group |
---|
66 | n/a | f.repeat_count = repeat_count |
---|
67 | n/a | return f |
---|
68 | n/a | return blah |
---|
69 | n/a | |
---|
70 | n/a | def uses_re(f): |
---|
71 | n/a | f.uses_re = True |
---|
72 | n/a | |
---|
73 | n/a | ####### 'in' comparisons |
---|
74 | n/a | |
---|
75 | n/a | @bench('"A" in "A"*1000', "early match, single character", 1000) |
---|
76 | n/a | def in_test_quick_match_single_character(STR): |
---|
77 | n/a | s1 = STR("A" * 1000) |
---|
78 | n/a | s2 = STR("A") |
---|
79 | n/a | for x in _RANGE_1000: |
---|
80 | n/a | s2 in s1 |
---|
81 | n/a | |
---|
82 | n/a | @bench('"B" in "A"*1000', "no match, single character", 1000) |
---|
83 | n/a | def in_test_no_match_single_character(STR): |
---|
84 | n/a | s1 = STR("A" * 1000) |
---|
85 | n/a | s2 = STR("B") |
---|
86 | n/a | for x in _RANGE_1000: |
---|
87 | n/a | s2 in s1 |
---|
88 | n/a | |
---|
89 | n/a | |
---|
90 | n/a | @bench('"AB" in "AB"*1000', "early match, two characters", 1000) |
---|
91 | n/a | def in_test_quick_match_two_characters(STR): |
---|
92 | n/a | s1 = STR("AB" * 1000) |
---|
93 | n/a | s2 = STR("AB") |
---|
94 | n/a | for x in _RANGE_1000: |
---|
95 | n/a | s2 in s1 |
---|
96 | n/a | |
---|
97 | n/a | @bench('"BC" in "AB"*1000', "no match, two characters", 1000) |
---|
98 | n/a | def in_test_no_match_two_character(STR): |
---|
99 | n/a | s1 = STR("AB" * 1000) |
---|
100 | n/a | s2 = STR("BC") |
---|
101 | n/a | for x in _RANGE_1000: |
---|
102 | n/a | s2 in s1 |
---|
103 | n/a | |
---|
104 | n/a | @bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000) |
---|
105 | n/a | def in_test_slow_match_two_characters(STR): |
---|
106 | n/a | s1 = STR("AB" * 300+"C") |
---|
107 | n/a | s2 = STR("BC") |
---|
108 | n/a | for x in _RANGE_1000: |
---|
109 | n/a | s2 in s1 |
---|
110 | n/a | |
---|
111 | n/a | @bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")', |
---|
112 | n/a | "late match, 100 characters", 100) |
---|
113 | n/a | def in_test_slow_match_100_characters(STR): |
---|
114 | n/a | m = STR("ABC"*33) |
---|
115 | n/a | d = STR("D") |
---|
116 | n/a | e = STR("E") |
---|
117 | n/a | s1 = (m+d)*300 + m+e |
---|
118 | n/a | s2 = m+e |
---|
119 | n/a | for x in _RANGE_100: |
---|
120 | n/a | s2 in s1 |
---|
121 | n/a | |
---|
122 | n/a | # Try with regex |
---|
123 | n/a | @uses_re |
---|
124 | n/a | @bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")', |
---|
125 | n/a | "late match, 100 characters", 100) |
---|
126 | n/a | def re_test_slow_match_100_characters(STR): |
---|
127 | n/a | m = STR("ABC"*33) |
---|
128 | n/a | d = STR("D") |
---|
129 | n/a | e = STR("E") |
---|
130 | n/a | s1 = (m+d)*300 + m+e |
---|
131 | n/a | s2 = m+e |
---|
132 | n/a | pat = re.compile(s2) |
---|
133 | n/a | search = pat.search |
---|
134 | n/a | for x in _RANGE_100: |
---|
135 | n/a | search(s1) |
---|
136 | n/a | |
---|
137 | n/a | |
---|
138 | n/a | #### same tests as 'in' but use 'find' |
---|
139 | n/a | |
---|
140 | n/a | @bench('("A"*1000).find("A")', "early match, single character", 1000) |
---|
141 | n/a | def find_test_quick_match_single_character(STR): |
---|
142 | n/a | s1 = STR("A" * 1000) |
---|
143 | n/a | s2 = STR("A") |
---|
144 | n/a | s1_find = s1.find |
---|
145 | n/a | for x in _RANGE_1000: |
---|
146 | n/a | s1_find(s2) |
---|
147 | n/a | |
---|
148 | n/a | @bench('("A"*1000).find("B")', "no match, single character", 1000) |
---|
149 | n/a | def find_test_no_match_single_character(STR): |
---|
150 | n/a | s1 = STR("A" * 1000) |
---|
151 | n/a | s2 = STR("B") |
---|
152 | n/a | s1_find = s1.find |
---|
153 | n/a | for x in _RANGE_1000: |
---|
154 | n/a | s1_find(s2) |
---|
155 | n/a | |
---|
156 | n/a | |
---|
157 | n/a | @bench('("AB"*1000).find("AB")', "early match, two characters", 1000) |
---|
158 | n/a | def find_test_quick_match_two_characters(STR): |
---|
159 | n/a | s1 = STR("AB" * 1000) |
---|
160 | n/a | s2 = STR("AB") |
---|
161 | n/a | s1_find = s1.find |
---|
162 | n/a | for x in _RANGE_1000: |
---|
163 | n/a | s1_find(s2) |
---|
164 | n/a | |
---|
165 | n/a | @bench('("AB"*1000).find("BC")', "no match, two characters", 1000) |
---|
166 | n/a | def find_test_no_match_two_character(STR): |
---|
167 | n/a | s1 = STR("AB" * 1000) |
---|
168 | n/a | s2 = STR("BC") |
---|
169 | n/a | s1_find = s1.find |
---|
170 | n/a | for x in _RANGE_1000: |
---|
171 | n/a | s1_find(s2) |
---|
172 | n/a | |
---|
173 | n/a | @bench('("AB"*1000).find("CA")', "no match, two characters", 1000) |
---|
174 | n/a | def find_test_no_match_two_character_bis(STR): |
---|
175 | n/a | s1 = STR("AB" * 1000) |
---|
176 | n/a | s2 = STR("CA") |
---|
177 | n/a | s1_find = s1.find |
---|
178 | n/a | for x in _RANGE_1000: |
---|
179 | n/a | s1_find(s2) |
---|
180 | n/a | |
---|
181 | n/a | @bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000) |
---|
182 | n/a | def find_test_slow_match_two_characters(STR): |
---|
183 | n/a | s1 = STR("AB" * 300+"C") |
---|
184 | n/a | s2 = STR("BC") |
---|
185 | n/a | s1_find = s1.find |
---|
186 | n/a | for x in _RANGE_1000: |
---|
187 | n/a | s1_find(s2) |
---|
188 | n/a | |
---|
189 | n/a | @bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000) |
---|
190 | n/a | def find_test_slow_match_two_characters_bis(STR): |
---|
191 | n/a | s1 = STR("AB" * 300+"CA") |
---|
192 | n/a | s2 = STR("CA") |
---|
193 | n/a | s1_find = s1.find |
---|
194 | n/a | for x in _RANGE_1000: |
---|
195 | n/a | s1_find(s2) |
---|
196 | n/a | |
---|
197 | n/a | @bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")', |
---|
198 | n/a | "late match, 100 characters", 100) |
---|
199 | n/a | def find_test_slow_match_100_characters(STR): |
---|
200 | n/a | m = STR("ABC"*33) |
---|
201 | n/a | d = STR("D") |
---|
202 | n/a | e = STR("E") |
---|
203 | n/a | s1 = (m+d)*500 + m+e |
---|
204 | n/a | s2 = m+e |
---|
205 | n/a | s1_find = s1.find |
---|
206 | n/a | for x in _RANGE_100: |
---|
207 | n/a | s1_find(s2) |
---|
208 | n/a | |
---|
209 | n/a | @bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)', |
---|
210 | n/a | "late match, 100 characters", 100) |
---|
211 | n/a | def find_test_slow_match_100_characters_bis(STR): |
---|
212 | n/a | m = STR("ABC"*33) |
---|
213 | n/a | d = STR("D") |
---|
214 | n/a | e = STR("E") |
---|
215 | n/a | s1 = (m+d)*500 + e+m |
---|
216 | n/a | s2 = e+m |
---|
217 | n/a | s1_find = s1.find |
---|
218 | n/a | for x in _RANGE_100: |
---|
219 | n/a | s1_find(s2) |
---|
220 | n/a | |
---|
221 | n/a | |
---|
222 | n/a | #### Same tests for 'rfind' |
---|
223 | n/a | |
---|
224 | n/a | @bench('("A"*1000).rfind("A")', "early match, single character", 1000) |
---|
225 | n/a | def rfind_test_quick_match_single_character(STR): |
---|
226 | n/a | s1 = STR("A" * 1000) |
---|
227 | n/a | s2 = STR("A") |
---|
228 | n/a | s1_rfind = s1.rfind |
---|
229 | n/a | for x in _RANGE_1000: |
---|
230 | n/a | s1_rfind(s2) |
---|
231 | n/a | |
---|
232 | n/a | @bench('("A"*1000).rfind("B")', "no match, single character", 1000) |
---|
233 | n/a | def rfind_test_no_match_single_character(STR): |
---|
234 | n/a | s1 = STR("A" * 1000) |
---|
235 | n/a | s2 = STR("B") |
---|
236 | n/a | s1_rfind = s1.rfind |
---|
237 | n/a | for x in _RANGE_1000: |
---|
238 | n/a | s1_rfind(s2) |
---|
239 | n/a | |
---|
240 | n/a | |
---|
241 | n/a | @bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000) |
---|
242 | n/a | def rfind_test_quick_match_two_characters(STR): |
---|
243 | n/a | s1 = STR("AB" * 1000) |
---|
244 | n/a | s2 = STR("AB") |
---|
245 | n/a | s1_rfind = s1.rfind |
---|
246 | n/a | for x in _RANGE_1000: |
---|
247 | n/a | s1_rfind(s2) |
---|
248 | n/a | |
---|
249 | n/a | @bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000) |
---|
250 | n/a | def rfind_test_no_match_two_character(STR): |
---|
251 | n/a | s1 = STR("AB" * 1000) |
---|
252 | n/a | s2 = STR("BC") |
---|
253 | n/a | s1_rfind = s1.rfind |
---|
254 | n/a | for x in _RANGE_1000: |
---|
255 | n/a | s1_rfind(s2) |
---|
256 | n/a | |
---|
257 | n/a | @bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000) |
---|
258 | n/a | def rfind_test_no_match_two_character_bis(STR): |
---|
259 | n/a | s1 = STR("AB" * 1000) |
---|
260 | n/a | s2 = STR("CA") |
---|
261 | n/a | s1_rfind = s1.rfind |
---|
262 | n/a | for x in _RANGE_1000: |
---|
263 | n/a | s1_rfind(s2) |
---|
264 | n/a | |
---|
265 | n/a | @bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000) |
---|
266 | n/a | def rfind_test_slow_match_two_characters(STR): |
---|
267 | n/a | s1 = STR("C" + "AB" * 300) |
---|
268 | n/a | s2 = STR("CA") |
---|
269 | n/a | s1_rfind = s1.rfind |
---|
270 | n/a | for x in _RANGE_1000: |
---|
271 | n/a | s1_rfind(s2) |
---|
272 | n/a | |
---|
273 | n/a | @bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000) |
---|
274 | n/a | def rfind_test_slow_match_two_characters_bis(STR): |
---|
275 | n/a | s1 = STR("BC" + "AB" * 300) |
---|
276 | n/a | s2 = STR("BC") |
---|
277 | n/a | s1_rfind = s1.rfind |
---|
278 | n/a | for x in _RANGE_1000: |
---|
279 | n/a | s1_rfind(s2) |
---|
280 | n/a | |
---|
281 | n/a | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)', |
---|
282 | n/a | "late match, 100 characters", 100) |
---|
283 | n/a | def rfind_test_slow_match_100_characters(STR): |
---|
284 | n/a | m = STR("ABC"*33) |
---|
285 | n/a | d = STR("D") |
---|
286 | n/a | e = STR("E") |
---|
287 | n/a | s1 = e+m + (d+m)*500 |
---|
288 | n/a | s2 = e+m |
---|
289 | n/a | s1_rfind = s1.rfind |
---|
290 | n/a | for x in _RANGE_100: |
---|
291 | n/a | s1_rfind(s2) |
---|
292 | n/a | |
---|
293 | n/a | @bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")', |
---|
294 | n/a | "late match, 100 characters", 100) |
---|
295 | n/a | def rfind_test_slow_match_100_characters_bis(STR): |
---|
296 | n/a | m = STR("ABC"*33) |
---|
297 | n/a | d = STR("D") |
---|
298 | n/a | e = STR("E") |
---|
299 | n/a | s1 = m+e + (d+m)*500 |
---|
300 | n/a | s2 = m+e |
---|
301 | n/a | s1_rfind = s1.rfind |
---|
302 | n/a | for x in _RANGE_100: |
---|
303 | n/a | s1_rfind(s2) |
---|
304 | n/a | |
---|
305 | n/a | |
---|
306 | n/a | #### Now with index. |
---|
307 | n/a | # Skip the ones which fail because that would include exception overhead. |
---|
308 | n/a | |
---|
309 | n/a | @bench('("A"*1000).index("A")', "early match, single character", 1000) |
---|
310 | n/a | def index_test_quick_match_single_character(STR): |
---|
311 | n/a | s1 = STR("A" * 1000) |
---|
312 | n/a | s2 = STR("A") |
---|
313 | n/a | s1_index = s1.index |
---|
314 | n/a | for x in _RANGE_1000: |
---|
315 | n/a | s1_index(s2) |
---|
316 | n/a | |
---|
317 | n/a | @bench('("AB"*1000).index("AB")', "early match, two characters", 1000) |
---|
318 | n/a | def index_test_quick_match_two_characters(STR): |
---|
319 | n/a | s1 = STR("AB" * 1000) |
---|
320 | n/a | s2 = STR("AB") |
---|
321 | n/a | s1_index = s1.index |
---|
322 | n/a | for x in _RANGE_1000: |
---|
323 | n/a | s1_index(s2) |
---|
324 | n/a | |
---|
325 | n/a | @bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000) |
---|
326 | n/a | def index_test_slow_match_two_characters(STR): |
---|
327 | n/a | s1 = STR("AB" * 300+"C") |
---|
328 | n/a | s2 = STR("BC") |
---|
329 | n/a | s1_index = s1.index |
---|
330 | n/a | for x in _RANGE_1000: |
---|
331 | n/a | s1_index(s2) |
---|
332 | n/a | |
---|
333 | n/a | @bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")', |
---|
334 | n/a | "late match, 100 characters", 100) |
---|
335 | n/a | def index_test_slow_match_100_characters(STR): |
---|
336 | n/a | m = STR("ABC"*33) |
---|
337 | n/a | d = STR("D") |
---|
338 | n/a | e = STR("E") |
---|
339 | n/a | s1 = (m+d)*500 + m+e |
---|
340 | n/a | s2 = m+e |
---|
341 | n/a | s1_index = s1.index |
---|
342 | n/a | for x in _RANGE_100: |
---|
343 | n/a | s1_index(s2) |
---|
344 | n/a | |
---|
345 | n/a | |
---|
346 | n/a | #### Same for rindex |
---|
347 | n/a | |
---|
348 | n/a | @bench('("A"*1000).rindex("A")', "early match, single character", 1000) |
---|
349 | n/a | def rindex_test_quick_match_single_character(STR): |
---|
350 | n/a | s1 = STR("A" * 1000) |
---|
351 | n/a | s2 = STR("A") |
---|
352 | n/a | s1_rindex = s1.rindex |
---|
353 | n/a | for x in _RANGE_1000: |
---|
354 | n/a | s1_rindex(s2) |
---|
355 | n/a | |
---|
356 | n/a | @bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000) |
---|
357 | n/a | def rindex_test_quick_match_two_characters(STR): |
---|
358 | n/a | s1 = STR("AB" * 1000) |
---|
359 | n/a | s2 = STR("AB") |
---|
360 | n/a | s1_rindex = s1.rindex |
---|
361 | n/a | for x in _RANGE_1000: |
---|
362 | n/a | s1_rindex(s2) |
---|
363 | n/a | |
---|
364 | n/a | @bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000) |
---|
365 | n/a | def rindex_test_slow_match_two_characters(STR): |
---|
366 | n/a | s1 = STR("C" + "AB" * 300) |
---|
367 | n/a | s2 = STR("CA") |
---|
368 | n/a | s1_rindex = s1.rindex |
---|
369 | n/a | for x in _RANGE_1000: |
---|
370 | n/a | s1_rindex(s2) |
---|
371 | n/a | |
---|
372 | n/a | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)', |
---|
373 | n/a | "late match, 100 characters", 100) |
---|
374 | n/a | def rindex_test_slow_match_100_characters(STR): |
---|
375 | n/a | m = STR("ABC"*33) |
---|
376 | n/a | d = STR("D") |
---|
377 | n/a | e = STR("E") |
---|
378 | n/a | s1 = e + m + (d+m)*500 |
---|
379 | n/a | s2 = e + m |
---|
380 | n/a | s1_rindex = s1.rindex |
---|
381 | n/a | for x in _RANGE_100: |
---|
382 | n/a | s1_rindex(s2) |
---|
383 | n/a | |
---|
384 | n/a | |
---|
385 | n/a | #### Same for partition |
---|
386 | n/a | |
---|
387 | n/a | @bench('("A"*1000).partition("A")', "early match, single character", 1000) |
---|
388 | n/a | def partition_test_quick_match_single_character(STR): |
---|
389 | n/a | s1 = STR("A" * 1000) |
---|
390 | n/a | s2 = STR("A") |
---|
391 | n/a | s1_partition = s1.partition |
---|
392 | n/a | for x in _RANGE_1000: |
---|
393 | n/a | s1_partition(s2) |
---|
394 | n/a | |
---|
395 | n/a | @bench('("A"*1000).partition("B")', "no match, single character", 1000) |
---|
396 | n/a | def partition_test_no_match_single_character(STR): |
---|
397 | n/a | s1 = STR("A" * 1000) |
---|
398 | n/a | s2 = STR("B") |
---|
399 | n/a | s1_partition = s1.partition |
---|
400 | n/a | for x in _RANGE_1000: |
---|
401 | n/a | s1_partition(s2) |
---|
402 | n/a | |
---|
403 | n/a | |
---|
404 | n/a | @bench('("AB"*1000).partition("AB")', "early match, two characters", 1000) |
---|
405 | n/a | def partition_test_quick_match_two_characters(STR): |
---|
406 | n/a | s1 = STR("AB" * 1000) |
---|
407 | n/a | s2 = STR("AB") |
---|
408 | n/a | s1_partition = s1.partition |
---|
409 | n/a | for x in _RANGE_1000: |
---|
410 | n/a | s1_partition(s2) |
---|
411 | n/a | |
---|
412 | n/a | @bench('("AB"*1000).partition("BC")', "no match, two characters", 1000) |
---|
413 | n/a | def partition_test_no_match_two_character(STR): |
---|
414 | n/a | s1 = STR("AB" * 1000) |
---|
415 | n/a | s2 = STR("BC") |
---|
416 | n/a | s1_partition = s1.partition |
---|
417 | n/a | for x in _RANGE_1000: |
---|
418 | n/a | s1_partition(s2) |
---|
419 | n/a | |
---|
420 | n/a | @bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000) |
---|
421 | n/a | def partition_test_slow_match_two_characters(STR): |
---|
422 | n/a | s1 = STR("AB" * 300+"C") |
---|
423 | n/a | s2 = STR("BC") |
---|
424 | n/a | s1_partition = s1.partition |
---|
425 | n/a | for x in _RANGE_1000: |
---|
426 | n/a | s1_partition(s2) |
---|
427 | n/a | |
---|
428 | n/a | @bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")', |
---|
429 | n/a | "late match, 100 characters", 100) |
---|
430 | n/a | def partition_test_slow_match_100_characters(STR): |
---|
431 | n/a | m = STR("ABC"*33) |
---|
432 | n/a | d = STR("D") |
---|
433 | n/a | e = STR("E") |
---|
434 | n/a | s1 = (m+d)*500 + m+e |
---|
435 | n/a | s2 = m+e |
---|
436 | n/a | s1_partition = s1.partition |
---|
437 | n/a | for x in _RANGE_100: |
---|
438 | n/a | s1_partition(s2) |
---|
439 | n/a | |
---|
440 | n/a | |
---|
441 | n/a | #### Same for rpartition |
---|
442 | n/a | |
---|
443 | n/a | @bench('("A"*1000).rpartition("A")', "early match, single character", 1000) |
---|
444 | n/a | def rpartition_test_quick_match_single_character(STR): |
---|
445 | n/a | s1 = STR("A" * 1000) |
---|
446 | n/a | s2 = STR("A") |
---|
447 | n/a | s1_rpartition = s1.rpartition |
---|
448 | n/a | for x in _RANGE_1000: |
---|
449 | n/a | s1_rpartition(s2) |
---|
450 | n/a | |
---|
451 | n/a | @bench('("A"*1000).rpartition("B")', "no match, single character", 1000) |
---|
452 | n/a | def rpartition_test_no_match_single_character(STR): |
---|
453 | n/a | s1 = STR("A" * 1000) |
---|
454 | n/a | s2 = STR("B") |
---|
455 | n/a | s1_rpartition = s1.rpartition |
---|
456 | n/a | for x in _RANGE_1000: |
---|
457 | n/a | s1_rpartition(s2) |
---|
458 | n/a | |
---|
459 | n/a | |
---|
460 | n/a | @bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000) |
---|
461 | n/a | def rpartition_test_quick_match_two_characters(STR): |
---|
462 | n/a | s1 = STR("AB" * 1000) |
---|
463 | n/a | s2 = STR("AB") |
---|
464 | n/a | s1_rpartition = s1.rpartition |
---|
465 | n/a | for x in _RANGE_1000: |
---|
466 | n/a | s1_rpartition(s2) |
---|
467 | n/a | |
---|
468 | n/a | @bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000) |
---|
469 | n/a | def rpartition_test_no_match_two_character(STR): |
---|
470 | n/a | s1 = STR("AB" * 1000) |
---|
471 | n/a | s2 = STR("BC") |
---|
472 | n/a | s1_rpartition = s1.rpartition |
---|
473 | n/a | for x in _RANGE_1000: |
---|
474 | n/a | s1_rpartition(s2) |
---|
475 | n/a | |
---|
476 | n/a | @bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000) |
---|
477 | n/a | def rpartition_test_slow_match_two_characters(STR): |
---|
478 | n/a | s1 = STR("C" + "AB" * 300) |
---|
479 | n/a | s2 = STR("CA") |
---|
480 | n/a | s1_rpartition = s1.rpartition |
---|
481 | n/a | for x in _RANGE_1000: |
---|
482 | n/a | s1_rpartition(s2) |
---|
483 | n/a | |
---|
484 | n/a | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)', |
---|
485 | n/a | "late match, 100 characters", 100) |
---|
486 | n/a | def rpartition_test_slow_match_100_characters(STR): |
---|
487 | n/a | m = STR("ABC"*33) |
---|
488 | n/a | d = STR("D") |
---|
489 | n/a | e = STR("E") |
---|
490 | n/a | s1 = e + m + (d+m)*500 |
---|
491 | n/a | s2 = e + m |
---|
492 | n/a | s1_rpartition = s1.rpartition |
---|
493 | n/a | for x in _RANGE_100: |
---|
494 | n/a | s1_rpartition(s2) |
---|
495 | n/a | |
---|
496 | n/a | |
---|
497 | n/a | #### Same for split(s, 1) |
---|
498 | n/a | |
---|
499 | n/a | @bench('("A"*1000).split("A", 1)', "early match, single character", 1000) |
---|
500 | n/a | def split_test_quick_match_single_character(STR): |
---|
501 | n/a | s1 = STR("A" * 1000) |
---|
502 | n/a | s2 = STR("A") |
---|
503 | n/a | s1_split = s1.split |
---|
504 | n/a | for x in _RANGE_1000: |
---|
505 | n/a | s1_split(s2, 1) |
---|
506 | n/a | |
---|
507 | n/a | @bench('("A"*1000).split("B", 1)', "no match, single character", 1000) |
---|
508 | n/a | def split_test_no_match_single_character(STR): |
---|
509 | n/a | s1 = STR("A" * 1000) |
---|
510 | n/a | s2 = STR("B") |
---|
511 | n/a | s1_split = s1.split |
---|
512 | n/a | for x in _RANGE_1000: |
---|
513 | n/a | s1_split(s2, 1) |
---|
514 | n/a | |
---|
515 | n/a | |
---|
516 | n/a | @bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000) |
---|
517 | n/a | def split_test_quick_match_two_characters(STR): |
---|
518 | n/a | s1 = STR("AB" * 1000) |
---|
519 | n/a | s2 = STR("AB") |
---|
520 | n/a | s1_split = s1.split |
---|
521 | n/a | for x in _RANGE_1000: |
---|
522 | n/a | s1_split(s2, 1) |
---|
523 | n/a | |
---|
524 | n/a | @bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000) |
---|
525 | n/a | def split_test_no_match_two_character(STR): |
---|
526 | n/a | s1 = STR("AB" * 1000) |
---|
527 | n/a | s2 = STR("BC") |
---|
528 | n/a | s1_split = s1.split |
---|
529 | n/a | for x in _RANGE_1000: |
---|
530 | n/a | s1_split(s2, 1) |
---|
531 | n/a | |
---|
532 | n/a | @bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000) |
---|
533 | n/a | def split_test_slow_match_two_characters(STR): |
---|
534 | n/a | s1 = STR("AB" * 300+"C") |
---|
535 | n/a | s2 = STR("BC") |
---|
536 | n/a | s1_split = s1.split |
---|
537 | n/a | for x in _RANGE_1000: |
---|
538 | n/a | s1_split(s2, 1) |
---|
539 | n/a | |
---|
540 | n/a | @bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)', |
---|
541 | n/a | "late match, 100 characters", 100) |
---|
542 | n/a | def split_test_slow_match_100_characters(STR): |
---|
543 | n/a | m = STR("ABC"*33) |
---|
544 | n/a | d = STR("D") |
---|
545 | n/a | e = STR("E") |
---|
546 | n/a | s1 = (m+d)*500 + m+e |
---|
547 | n/a | s2 = m+e |
---|
548 | n/a | s1_split = s1.split |
---|
549 | n/a | for x in _RANGE_100: |
---|
550 | n/a | s1_split(s2, 1) |
---|
551 | n/a | |
---|
552 | n/a | |
---|
553 | n/a | #### Same for rsplit(s, 1) |
---|
554 | n/a | |
---|
555 | n/a | @bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000) |
---|
556 | n/a | def rsplit_test_quick_match_single_character(STR): |
---|
557 | n/a | s1 = STR("A" * 1000) |
---|
558 | n/a | s2 = STR("A") |
---|
559 | n/a | s1_rsplit = s1.rsplit |
---|
560 | n/a | for x in _RANGE_1000: |
---|
561 | n/a | s1_rsplit(s2, 1) |
---|
562 | n/a | |
---|
563 | n/a | @bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000) |
---|
564 | n/a | def rsplit_test_no_match_single_character(STR): |
---|
565 | n/a | s1 = STR("A" * 1000) |
---|
566 | n/a | s2 = STR("B") |
---|
567 | n/a | s1_rsplit = s1.rsplit |
---|
568 | n/a | for x in _RANGE_1000: |
---|
569 | n/a | s1_rsplit(s2, 1) |
---|
570 | n/a | |
---|
571 | n/a | |
---|
572 | n/a | @bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000) |
---|
573 | n/a | def rsplit_test_quick_match_two_characters(STR): |
---|
574 | n/a | s1 = STR("AB" * 1000) |
---|
575 | n/a | s2 = STR("AB") |
---|
576 | n/a | s1_rsplit = s1.rsplit |
---|
577 | n/a | for x in _RANGE_1000: |
---|
578 | n/a | s1_rsplit(s2, 1) |
---|
579 | n/a | |
---|
580 | n/a | @bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000) |
---|
581 | n/a | def rsplit_test_no_match_two_character(STR): |
---|
582 | n/a | s1 = STR("AB" * 1000) |
---|
583 | n/a | s2 = STR("BC") |
---|
584 | n/a | s1_rsplit = s1.rsplit |
---|
585 | n/a | for x in _RANGE_1000: |
---|
586 | n/a | s1_rsplit(s2, 1) |
---|
587 | n/a | |
---|
588 | n/a | @bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000) |
---|
589 | n/a | def rsplit_test_slow_match_two_characters(STR): |
---|
590 | n/a | s1 = STR("C" + "AB" * 300) |
---|
591 | n/a | s2 = STR("CA") |
---|
592 | n/a | s1_rsplit = s1.rsplit |
---|
593 | n/a | for x in _RANGE_1000: |
---|
594 | n/a | s1_rsplit(s2, 1) |
---|
595 | n/a | |
---|
596 | n/a | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)', |
---|
597 | n/a | "late match, 100 characters", 100) |
---|
598 | n/a | def rsplit_test_slow_match_100_characters(STR): |
---|
599 | n/a | m = STR("ABC"*33) |
---|
600 | n/a | d = STR("D") |
---|
601 | n/a | e = STR("E") |
---|
602 | n/a | s1 = e + m + (d+m)*500 |
---|
603 | n/a | s2 = e + m |
---|
604 | n/a | s1_rsplit = s1.rsplit |
---|
605 | n/a | for x in _RANGE_100: |
---|
606 | n/a | s1_rsplit(s2, 1) |
---|
607 | n/a | |
---|
608 | n/a | |
---|
609 | n/a | #### Benchmark the operator-based methods |
---|
610 | n/a | |
---|
611 | n/a | @bench('"A"*10', "repeat 1 character 10 times", 1000) |
---|
612 | n/a | def repeat_single_10_times(STR): |
---|
613 | n/a | s = STR("A") |
---|
614 | n/a | for x in _RANGE_1000: |
---|
615 | n/a | s * 10 |
---|
616 | n/a | |
---|
617 | n/a | @bench('"A"*1000', "repeat 1 character 1000 times", 1000) |
---|
618 | n/a | def repeat_single_1000_times(STR): |
---|
619 | n/a | s = STR("A") |
---|
620 | n/a | for x in _RANGE_1000: |
---|
621 | n/a | s * 1000 |
---|
622 | n/a | |
---|
623 | n/a | @bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000) |
---|
624 | n/a | def repeat_5_10_times(STR): |
---|
625 | n/a | s = STR("ABCDE") |
---|
626 | n/a | for x in _RANGE_1000: |
---|
627 | n/a | s * 10 |
---|
628 | n/a | |
---|
629 | n/a | @bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000) |
---|
630 | n/a | def repeat_5_1000_times(STR): |
---|
631 | n/a | s = STR("ABCDE") |
---|
632 | n/a | for x in _RANGE_1000: |
---|
633 | n/a | s * 1000 |
---|
634 | n/a | |
---|
635 | n/a | # + for concat |
---|
636 | n/a | |
---|
637 | n/a | @bench('"Andrew"+"Dalke"', "concat two strings", 1000) |
---|
638 | n/a | def concat_two_strings(STR): |
---|
639 | n/a | s1 = STR("Andrew") |
---|
640 | n/a | s2 = STR("Dalke") |
---|
641 | n/a | for x in _RANGE_1000: |
---|
642 | n/a | s1+s2 |
---|
643 | n/a | |
---|
644 | n/a | @bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15", |
---|
645 | n/a | 1000) |
---|
646 | n/a | def concat_many_strings(STR): |
---|
647 | n/a | s1=STR('TIXSGYNREDCVBHJ') |
---|
648 | n/a | s2=STR('PUMTLXBZVDO') |
---|
649 | n/a | s3=STR('FVZNJ') |
---|
650 | n/a | s4=STR('OGDXUW') |
---|
651 | n/a | s5=STR('WEIMRNCOYVGHKB') |
---|
652 | n/a | s6=STR('FCQTNMXPUZH') |
---|
653 | n/a | s7=STR('TICZJYRLBNVUEAK') |
---|
654 | n/a | s8=STR('REYB') |
---|
655 | n/a | s9=STR('PWUOQ') |
---|
656 | n/a | s10=STR('EQHCMKBS') |
---|
657 | n/a | s11=STR('AEVDFOH') |
---|
658 | n/a | s12=STR('IFHVD') |
---|
659 | n/a | s13=STR('JGTCNLXWOHQ') |
---|
660 | n/a | s14=STR('ITSKEPYLROZAWXF') |
---|
661 | n/a | s15=STR('THEK') |
---|
662 | n/a | s16=STR('GHPZFBUYCKMNJIT') |
---|
663 | n/a | s17=STR('JMUZ') |
---|
664 | n/a | s18=STR('WLZQMTB') |
---|
665 | n/a | s19=STR('KPADCBW') |
---|
666 | n/a | s20=STR('TNJHZQAGBU') |
---|
667 | n/a | for x in _RANGE_1000: |
---|
668 | n/a | (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+ |
---|
669 | n/a | s11+s12+s13+s14+s15+s16+s17+s18+s19+s20) |
---|
670 | n/a | |
---|
671 | n/a | |
---|
672 | n/a | #### Benchmark join |
---|
673 | n/a | |
---|
674 | n/a | def get_bytes_yielding_seq(STR, arg): |
---|
675 | n/a | if STR is BYTES and sys.version_info >= (3,): |
---|
676 | n/a | raise UnsupportedType |
---|
677 | n/a | return STR(arg) |
---|
678 | n/a | |
---|
679 | n/a | @bench('"A".join("")', |
---|
680 | n/a | "join empty string, with 1 character sep", 100) |
---|
681 | n/a | def join_empty_single(STR): |
---|
682 | n/a | sep = STR("A") |
---|
683 | n/a | s2 = get_bytes_yielding_seq(STR, "") |
---|
684 | n/a | sep_join = sep.join |
---|
685 | n/a | for x in _RANGE_100: |
---|
686 | n/a | sep_join(s2) |
---|
687 | n/a | |
---|
688 | n/a | @bench('"ABCDE".join("")', |
---|
689 | n/a | "join empty string, with 5 character sep", 100) |
---|
690 | n/a | def join_empty_5(STR): |
---|
691 | n/a | sep = STR("ABCDE") |
---|
692 | n/a | s2 = get_bytes_yielding_seq(STR, "") |
---|
693 | n/a | sep_join = sep.join |
---|
694 | n/a | for x in _RANGE_100: |
---|
695 | n/a | sep_join(s2) |
---|
696 | n/a | |
---|
697 | n/a | @bench('"A".join("ABC..Z")', |
---|
698 | n/a | "join string with 26 characters, with 1 character sep", 1000) |
---|
699 | n/a | def join_alphabet_single(STR): |
---|
700 | n/a | sep = STR("A") |
---|
701 | n/a | s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") |
---|
702 | n/a | sep_join = sep.join |
---|
703 | n/a | for x in _RANGE_1000: |
---|
704 | n/a | sep_join(s2) |
---|
705 | n/a | |
---|
706 | n/a | @bench('"ABCDE".join("ABC..Z")', |
---|
707 | n/a | "join string with 26 characters, with 5 character sep", 1000) |
---|
708 | n/a | def join_alphabet_5(STR): |
---|
709 | n/a | sep = STR("ABCDE") |
---|
710 | n/a | s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") |
---|
711 | n/a | sep_join = sep.join |
---|
712 | n/a | for x in _RANGE_1000: |
---|
713 | n/a | sep_join(s2) |
---|
714 | n/a | |
---|
715 | n/a | @bench('"A".join(list("ABC..Z"))', |
---|
716 | n/a | "join list of 26 characters, with 1 character sep", 1000) |
---|
717 | n/a | def join_alphabet_list_single(STR): |
---|
718 | n/a | sep = STR("A") |
---|
719 | n/a | s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] |
---|
720 | n/a | sep_join = sep.join |
---|
721 | n/a | for x in _RANGE_1000: |
---|
722 | n/a | sep_join(s2) |
---|
723 | n/a | |
---|
724 | n/a | @bench('"ABCDE".join(list("ABC..Z"))', |
---|
725 | n/a | "join list of 26 characters, with 5 character sep", 1000) |
---|
726 | n/a | def join_alphabet_list_five(STR): |
---|
727 | n/a | sep = STR("ABCDE") |
---|
728 | n/a | s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] |
---|
729 | n/a | sep_join = sep.join |
---|
730 | n/a | for x in _RANGE_1000: |
---|
731 | n/a | sep_join(s2) |
---|
732 | n/a | |
---|
733 | n/a | @bench('"A".join(["Bob"]*100))', |
---|
734 | n/a | "join list of 100 words, with 1 character sep", 1000) |
---|
735 | n/a | def join_100_words_single(STR): |
---|
736 | n/a | sep = STR("A") |
---|
737 | n/a | s2 = [STR("Bob")]*100 |
---|
738 | n/a | sep_join = sep.join |
---|
739 | n/a | for x in _RANGE_1000: |
---|
740 | n/a | sep_join(s2) |
---|
741 | n/a | |
---|
742 | n/a | @bench('"ABCDE".join(["Bob"]*100))', |
---|
743 | n/a | "join list of 100 words, with 5 character sep", 1000) |
---|
744 | n/a | def join_100_words_5(STR): |
---|
745 | n/a | sep = STR("ABCDE") |
---|
746 | n/a | s2 = [STR("Bob")]*100 |
---|
747 | n/a | sep_join = sep.join |
---|
748 | n/a | for x in _RANGE_1000: |
---|
749 | n/a | sep_join(s2) |
---|
750 | n/a | |
---|
751 | n/a | #### split tests |
---|
752 | n/a | |
---|
753 | n/a | @bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000) |
---|
754 | n/a | def whitespace_split(STR): |
---|
755 | n/a | s = STR("Here are some words. "*2) |
---|
756 | n/a | s_split = s.split |
---|
757 | n/a | for x in _RANGE_1000: |
---|
758 | n/a | s_split() |
---|
759 | n/a | |
---|
760 | n/a | @bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000) |
---|
761 | n/a | def whitespace_rsplit(STR): |
---|
762 | n/a | s = STR("Here are some words. "*2) |
---|
763 | n/a | s_rsplit = s.rsplit |
---|
764 | n/a | for x in _RANGE_1000: |
---|
765 | n/a | s_rsplit() |
---|
766 | n/a | |
---|
767 | n/a | @bench('("Here are some words. "*2).split(None, 1)', |
---|
768 | n/a | "split 1 whitespace", 1000) |
---|
769 | n/a | def whitespace_split_1(STR): |
---|
770 | n/a | s = STR("Here are some words. "*2) |
---|
771 | n/a | s_split = s.split |
---|
772 | n/a | N = None |
---|
773 | n/a | for x in _RANGE_1000: |
---|
774 | n/a | s_split(N, 1) |
---|
775 | n/a | |
---|
776 | n/a | @bench('("Here are some words. "*2).rsplit(None, 1)', |
---|
777 | n/a | "split 1 whitespace", 1000) |
---|
778 | n/a | def whitespace_rsplit_1(STR): |
---|
779 | n/a | s = STR("Here are some words. "*2) |
---|
780 | n/a | s_rsplit = s.rsplit |
---|
781 | n/a | N = None |
---|
782 | n/a | for x in _RANGE_1000: |
---|
783 | n/a | s_rsplit(N, 1) |
---|
784 | n/a | |
---|
785 | n/a | @bench('("Here are some words. "*2).partition(" ")', |
---|
786 | n/a | "split 1 whitespace", 1000) |
---|
787 | n/a | def whitespace_partition(STR): |
---|
788 | n/a | sep = STR(" ") |
---|
789 | n/a | s = STR("Here are some words. "*2) |
---|
790 | n/a | s_partition = s.partition |
---|
791 | n/a | for x in _RANGE_1000: |
---|
792 | n/a | s_partition(sep) |
---|
793 | n/a | |
---|
794 | n/a | @bench('("Here are some words. "*2).rpartition(" ")', |
---|
795 | n/a | "split 1 whitespace", 1000) |
---|
796 | n/a | def whitespace_rpartition(STR): |
---|
797 | n/a | sep = STR(" ") |
---|
798 | n/a | s = STR("Here are some words. "*2) |
---|
799 | n/a | s_rpartition = s.rpartition |
---|
800 | n/a | for x in _RANGE_1000: |
---|
801 | n/a | s_rpartition(sep) |
---|
802 | n/a | |
---|
803 | n/a | human_text = """\ |
---|
804 | n/a | Python is a dynamic object-oriented programming language that can be |
---|
805 | n/a | used for many kinds of software development. It offers strong support |
---|
806 | n/a | for integration with other languages and tools, comes with extensive |
---|
807 | n/a | standard libraries, and can be learned in a few days. Many Python |
---|
808 | n/a | programmers report substantial productivity gains and feel the language |
---|
809 | n/a | encourages the development of higher quality, more maintainable code. |
---|
810 | n/a | |
---|
811 | n/a | Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm |
---|
812 | n/a | Handhelds, and Nokia mobile phones. Python has also been ported to the |
---|
813 | n/a | Java and .NET virtual machines. |
---|
814 | n/a | |
---|
815 | n/a | Python is distributed under an OSI-approved open source license that |
---|
816 | n/a | makes it free to use, even for commercial products. |
---|
817 | n/a | """*25 |
---|
818 | n/a | human_text_bytes = bytes_from_str(human_text) |
---|
819 | n/a | human_text_unicode = unicode_from_str(human_text) |
---|
820 | n/a | def _get_human_text(STR): |
---|
821 | n/a | if STR is UNICODE: |
---|
822 | n/a | return human_text_unicode |
---|
823 | n/a | if STR is BYTES: |
---|
824 | n/a | return human_text_bytes |
---|
825 | n/a | raise AssertionError |
---|
826 | n/a | |
---|
827 | n/a | @bench('human_text.split()', "split whitespace (huge)", 10) |
---|
828 | n/a | def whitespace_split_huge(STR): |
---|
829 | n/a | s = _get_human_text(STR) |
---|
830 | n/a | s_split = s.split |
---|
831 | n/a | for x in _RANGE_10: |
---|
832 | n/a | s_split() |
---|
833 | n/a | |
---|
834 | n/a | @bench('human_text.rsplit()', "split whitespace (huge)", 10) |
---|
835 | n/a | def whitespace_rsplit_huge(STR): |
---|
836 | n/a | s = _get_human_text(STR) |
---|
837 | n/a | s_rsplit = s.rsplit |
---|
838 | n/a | for x in _RANGE_10: |
---|
839 | n/a | s_rsplit() |
---|
840 | n/a | |
---|
841 | n/a | |
---|
842 | n/a | |
---|
843 | n/a | @bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000) |
---|
844 | n/a | def newlines_split(STR): |
---|
845 | n/a | s = STR("this\nis\na\ntest\n") |
---|
846 | n/a | s_split = s.split |
---|
847 | n/a | nl = STR("\n") |
---|
848 | n/a | for x in _RANGE_1000: |
---|
849 | n/a | s_split(nl) |
---|
850 | n/a | |
---|
851 | n/a | |
---|
852 | n/a | @bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000) |
---|
853 | n/a | def newlines_rsplit(STR): |
---|
854 | n/a | s = STR("this\nis\na\ntest\n") |
---|
855 | n/a | s_rsplit = s.rsplit |
---|
856 | n/a | nl = STR("\n") |
---|
857 | n/a | for x in _RANGE_1000: |
---|
858 | n/a | s_rsplit(nl) |
---|
859 | n/a | |
---|
860 | n/a | @bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000) |
---|
861 | n/a | def newlines_splitlines(STR): |
---|
862 | n/a | s = STR("this\nis\na\ntest\n") |
---|
863 | n/a | s_splitlines = s.splitlines |
---|
864 | n/a | for x in _RANGE_1000: |
---|
865 | n/a | s_splitlines() |
---|
866 | n/a | |
---|
867 | n/a | ## split text with 2000 newlines |
---|
868 | n/a | |
---|
869 | n/a | def _make_2000_lines(): |
---|
870 | n/a | import random |
---|
871 | n/a | r = random.Random(100) |
---|
872 | n/a | chars = list(map(chr, range(32, 128))) |
---|
873 | n/a | i = 0 |
---|
874 | n/a | while i < len(chars): |
---|
875 | n/a | chars[i] = " " |
---|
876 | n/a | i += r.randrange(9) |
---|
877 | n/a | s = "".join(chars) |
---|
878 | n/a | s = s*4 |
---|
879 | n/a | words = [] |
---|
880 | n/a | for i in range(2000): |
---|
881 | n/a | start = r.randrange(96) |
---|
882 | n/a | n = r.randint(5, 65) |
---|
883 | n/a | words.append(s[start:start+n]) |
---|
884 | n/a | return "\n".join(words)+"\n" |
---|
885 | n/a | |
---|
886 | n/a | _text_with_2000_lines = _make_2000_lines() |
---|
887 | n/a | _text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines) |
---|
888 | n/a | _text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines) |
---|
889 | n/a | def _get_2000_lines(STR): |
---|
890 | n/a | if STR is UNICODE: |
---|
891 | n/a | return _text_with_2000_lines_unicode |
---|
892 | n/a | if STR is BYTES: |
---|
893 | n/a | return _text_with_2000_lines_bytes |
---|
894 | n/a | raise AssertionError |
---|
895 | n/a | |
---|
896 | n/a | |
---|
897 | n/a | @bench('"...text...".split("\\n")', "split 2000 newlines", 10) |
---|
898 | n/a | def newlines_split_2000(STR): |
---|
899 | n/a | s = _get_2000_lines(STR) |
---|
900 | n/a | s_split = s.split |
---|
901 | n/a | nl = STR("\n") |
---|
902 | n/a | for x in _RANGE_10: |
---|
903 | n/a | s_split(nl) |
---|
904 | n/a | |
---|
905 | n/a | @bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10) |
---|
906 | n/a | def newlines_rsplit_2000(STR): |
---|
907 | n/a | s = _get_2000_lines(STR) |
---|
908 | n/a | s_rsplit = s.rsplit |
---|
909 | n/a | nl = STR("\n") |
---|
910 | n/a | for x in _RANGE_10: |
---|
911 | n/a | s_rsplit(nl) |
---|
912 | n/a | |
---|
913 | n/a | @bench('"...text...".splitlines()', "split 2000 newlines", 10) |
---|
914 | n/a | def newlines_splitlines_2000(STR): |
---|
915 | n/a | s = _get_2000_lines(STR) |
---|
916 | n/a | s_splitlines = s.splitlines |
---|
917 | n/a | for x in _RANGE_10: |
---|
918 | n/a | s_splitlines() |
---|
919 | n/a | |
---|
920 | n/a | |
---|
921 | n/a | ## split text on "--" characters |
---|
922 | n/a | @bench( |
---|
923 | n/a | '"this--is--a--test--of--the--emergency--broadcast--system".split("--")', |
---|
924 | n/a | "split on multicharacter separator (small)", 1000) |
---|
925 | n/a | def split_multichar_sep_small(STR): |
---|
926 | n/a | s = STR("this--is--a--test--of--the--emergency--broadcast--system") |
---|
927 | n/a | s_split = s.split |
---|
928 | n/a | pat = STR("--") |
---|
929 | n/a | for x in _RANGE_1000: |
---|
930 | n/a | s_split(pat) |
---|
931 | n/a | @bench( |
---|
932 | n/a | '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")', |
---|
933 | n/a | "split on multicharacter separator (small)", 1000) |
---|
934 | n/a | def rsplit_multichar_sep_small(STR): |
---|
935 | n/a | s = STR("this--is--a--test--of--the--emergency--broadcast--system") |
---|
936 | n/a | s_rsplit = s.rsplit |
---|
937 | n/a | pat = STR("--") |
---|
938 | n/a | for x in _RANGE_1000: |
---|
939 | n/a | s_rsplit(pat) |
---|
940 | n/a | |
---|
941 | n/a | ## split dna text on "ACTAT" characters |
---|
942 | n/a | @bench('dna.split("ACTAT")', |
---|
943 | n/a | "split on multicharacter separator (dna)", 10) |
---|
944 | n/a | def split_multichar_sep_dna(STR): |
---|
945 | n/a | s = _get_dna(STR) |
---|
946 | n/a | s_split = s.split |
---|
947 | n/a | pat = STR("ACTAT") |
---|
948 | n/a | for x in _RANGE_10: |
---|
949 | n/a | s_split(pat) |
---|
950 | n/a | |
---|
951 | n/a | @bench('dna.rsplit("ACTAT")', |
---|
952 | n/a | "split on multicharacter separator (dna)", 10) |
---|
953 | n/a | def rsplit_multichar_sep_dna(STR): |
---|
954 | n/a | s = _get_dna(STR) |
---|
955 | n/a | s_rsplit = s.rsplit |
---|
956 | n/a | pat = STR("ACTAT") |
---|
957 | n/a | for x in _RANGE_10: |
---|
958 | n/a | s_rsplit(pat) |
---|
959 | n/a | |
---|
960 | n/a | |
---|
961 | n/a | |
---|
962 | n/a | ## split with limits |
---|
963 | n/a | |
---|
964 | n/a | GFF3_example = "\t".join([ |
---|
965 | n/a | "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".", |
---|
966 | n/a | "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"]) |
---|
967 | n/a | |
---|
968 | n/a | @bench('GFF3_example.split("\\t")', "tab split", 1000) |
---|
969 | n/a | def tab_split_no_limit(STR): |
---|
970 | n/a | sep = STR("\t") |
---|
971 | n/a | s = STR(GFF3_example) |
---|
972 | n/a | s_split = s.split |
---|
973 | n/a | for x in _RANGE_1000: |
---|
974 | n/a | s_split(sep) |
---|
975 | n/a | |
---|
976 | n/a | @bench('GFF3_example.split("\\t", 8)', "tab split", 1000) |
---|
977 | n/a | def tab_split_limit(STR): |
---|
978 | n/a | sep = STR("\t") |
---|
979 | n/a | s = STR(GFF3_example) |
---|
980 | n/a | s_split = s.split |
---|
981 | n/a | for x in _RANGE_1000: |
---|
982 | n/a | s_split(sep, 8) |
---|
983 | n/a | |
---|
984 | n/a | @bench('GFF3_example.rsplit("\\t")', "tab split", 1000) |
---|
985 | n/a | def tab_rsplit_no_limit(STR): |
---|
986 | n/a | sep = STR("\t") |
---|
987 | n/a | s = STR(GFF3_example) |
---|
988 | n/a | s_rsplit = s.rsplit |
---|
989 | n/a | for x in _RANGE_1000: |
---|
990 | n/a | s_rsplit(sep) |
---|
991 | n/a | |
---|
992 | n/a | @bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000) |
---|
993 | n/a | def tab_rsplit_limit(STR): |
---|
994 | n/a | sep = STR("\t") |
---|
995 | n/a | s = STR(GFF3_example) |
---|
996 | n/a | s_rsplit = s.rsplit |
---|
997 | n/a | for x in _RANGE_1000: |
---|
998 | n/a | s_rsplit(sep, 8) |
---|
999 | n/a | |
---|
1000 | n/a | #### Count characters |
---|
1001 | n/a | |
---|
1002 | n/a | @bench('...text.with.2000.newlines.count("\\n")', |
---|
1003 | n/a | "count newlines", 10) |
---|
1004 | n/a | def count_newlines(STR): |
---|
1005 | n/a | s = _get_2000_lines(STR) |
---|
1006 | n/a | s_count = s.count |
---|
1007 | n/a | nl = STR("\n") |
---|
1008 | n/a | for x in _RANGE_10: |
---|
1009 | n/a | s_count(nl) |
---|
1010 | n/a | |
---|
1011 | n/a | # Orchid sequences concatenated, from Biopython |
---|
1012 | n/a | _dna = """ |
---|
1013 | n/a | CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT |
---|
1014 | n/a | AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG |
---|
1015 | n/a | AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT |
---|
1016 | n/a | TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC |
---|
1017 | n/a | AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG |
---|
1018 | n/a | TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT |
---|
1019 | n/a | CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT |
---|
1020 | n/a | TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT |
---|
1021 | n/a | GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC |
---|
1022 | n/a | TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG |
---|
1023 | n/a | GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA |
---|
1024 | n/a | ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC |
---|
1025 | n/a | CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA |
---|
1026 | n/a | ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA |
---|
1027 | n/a | ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA |
---|
1028 | n/a | TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG |
---|
1029 | n/a | CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG |
---|
1030 | n/a | GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA |
---|
1031 | n/a | ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG |
---|
1032 | n/a | ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC |
---|
1033 | n/a | ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA |
---|
1034 | n/a | GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA |
---|
1035 | n/a | TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG |
---|
1036 | n/a | TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT |
---|
1037 | n/a | TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG |
---|
1038 | n/a | GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG |
---|
1039 | n/a | GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT |
---|
1040 | n/a | AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC |
---|
1041 | n/a | GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG |
---|
1042 | n/a | TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT |
---|
1043 | n/a | CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA |
---|
1044 | n/a | TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC |
---|
1045 | n/a | TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC |
---|
1046 | n/a | AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT |
---|
1047 | n/a | GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT |
---|
1048 | n/a | GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA |
---|
1049 | n/a | CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG |
---|
1050 | n/a | GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA |
---|
1051 | n/a | TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG |
---|
1052 | n/a | ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT |
---|
1053 | n/a | GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA |
---|
1054 | n/a | AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC |
---|
1055 | n/a | AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA |
---|
1056 | n/a | ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC |
---|
1057 | n/a | GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC |
---|
1058 | n/a | GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC |
---|
1059 | n/a | AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA |
---|
1060 | n/a | GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG |
---|
1061 | n/a | ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC |
---|
1062 | n/a | GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC |
---|
1063 | n/a | """ |
---|
1064 | n/a | _dna = "".join(_dna.splitlines()) |
---|
1065 | n/a | _dna = _dna * 25 |
---|
1066 | n/a | _dna_bytes = bytes_from_str(_dna) |
---|
1067 | n/a | _dna_unicode = unicode_from_str(_dna) |
---|
1068 | n/a | |
---|
1069 | n/a | def _get_dna(STR): |
---|
1070 | n/a | if STR is UNICODE: |
---|
1071 | n/a | return _dna_unicode |
---|
1072 | n/a | if STR is BYTES: |
---|
1073 | n/a | return _dna_bytes |
---|
1074 | n/a | raise AssertionError |
---|
1075 | n/a | |
---|
1076 | n/a | @bench('dna.count("AACT")', "count AACT substrings in DNA example", 10) |
---|
1077 | n/a | def count_aact(STR): |
---|
1078 | n/a | seq = _get_dna(STR) |
---|
1079 | n/a | seq_count = seq.count |
---|
1080 | n/a | needle = STR("AACT") |
---|
1081 | n/a | for x in _RANGE_10: |
---|
1082 | n/a | seq_count(needle) |
---|
1083 | n/a | |
---|
1084 | n/a | ##### startswith and endswith |
---|
1085 | n/a | |
---|
1086 | n/a | @bench('"Andrew".startswith("A")', 'startswith single character', 1000) |
---|
1087 | n/a | def startswith_single(STR): |
---|
1088 | n/a | s1 = STR("Andrew") |
---|
1089 | n/a | s2 = STR("A") |
---|
1090 | n/a | s1_startswith = s1.startswith |
---|
1091 | n/a | for x in _RANGE_1000: |
---|
1092 | n/a | s1_startswith(s2) |
---|
1093 | n/a | |
---|
1094 | n/a | @bench('"Andrew".startswith("Andrew")', 'startswith multiple characters', |
---|
1095 | n/a | 1000) |
---|
1096 | n/a | def startswith_multiple(STR): |
---|
1097 | n/a | s1 = STR("Andrew") |
---|
1098 | n/a | s2 = STR("Andrew") |
---|
1099 | n/a | s1_startswith = s1.startswith |
---|
1100 | n/a | for x in _RANGE_1000: |
---|
1101 | n/a | s1_startswith(s2) |
---|
1102 | n/a | |
---|
1103 | n/a | @bench('"Andrew".startswith("Anders")', |
---|
1104 | n/a | 'startswith multiple characters - not!', 1000) |
---|
1105 | n/a | def startswith_multiple_not(STR): |
---|
1106 | n/a | s1 = STR("Andrew") |
---|
1107 | n/a | s2 = STR("Anders") |
---|
1108 | n/a | s1_startswith = s1.startswith |
---|
1109 | n/a | for x in _RANGE_1000: |
---|
1110 | n/a | s1_startswith(s2) |
---|
1111 | n/a | |
---|
1112 | n/a | |
---|
1113 | n/a | # endswith |
---|
1114 | n/a | |
---|
1115 | n/a | @bench('"Andrew".endswith("w")', 'endswith single character', 1000) |
---|
1116 | n/a | def endswith_single(STR): |
---|
1117 | n/a | s1 = STR("Andrew") |
---|
1118 | n/a | s2 = STR("w") |
---|
1119 | n/a | s1_endswith = s1.endswith |
---|
1120 | n/a | for x in _RANGE_1000: |
---|
1121 | n/a | s1_endswith(s2) |
---|
1122 | n/a | |
---|
1123 | n/a | @bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000) |
---|
1124 | n/a | def endswith_multiple(STR): |
---|
1125 | n/a | s1 = STR("Andrew") |
---|
1126 | n/a | s2 = STR("Andrew") |
---|
1127 | n/a | s1_endswith = s1.endswith |
---|
1128 | n/a | for x in _RANGE_1000: |
---|
1129 | n/a | s1_endswith(s2) |
---|
1130 | n/a | |
---|
1131 | n/a | @bench('"Andrew".endswith("Anders")', |
---|
1132 | n/a | 'endswith multiple characters - not!', 1000) |
---|
1133 | n/a | def endswith_multiple_not(STR): |
---|
1134 | n/a | s1 = STR("Andrew") |
---|
1135 | n/a | s2 = STR("Anders") |
---|
1136 | n/a | s1_endswith = s1.endswith |
---|
1137 | n/a | for x in _RANGE_1000: |
---|
1138 | n/a | s1_endswith(s2) |
---|
1139 | n/a | |
---|
1140 | n/a | #### Strip |
---|
1141 | n/a | |
---|
1142 | n/a | @bench('"Hello!\\n".strip()', 'strip terminal newline', 1000) |
---|
1143 | n/a | def terminal_newline_strip_right(STR): |
---|
1144 | n/a | s = STR("Hello!\n") |
---|
1145 | n/a | s_strip = s.strip |
---|
1146 | n/a | for x in _RANGE_1000: |
---|
1147 | n/a | s_strip() |
---|
1148 | n/a | |
---|
1149 | n/a | @bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000) |
---|
1150 | n/a | def terminal_newline_rstrip(STR): |
---|
1151 | n/a | s = STR("Hello!\n") |
---|
1152 | n/a | s_rstrip = s.rstrip |
---|
1153 | n/a | for x in _RANGE_1000: |
---|
1154 | n/a | s_rstrip() |
---|
1155 | n/a | |
---|
1156 | n/a | @bench('"\\nHello!".strip()', 'strip terminal newline', 1000) |
---|
1157 | n/a | def terminal_newline_strip_left(STR): |
---|
1158 | n/a | s = STR("\nHello!") |
---|
1159 | n/a | s_strip = s.strip |
---|
1160 | n/a | for x in _RANGE_1000: |
---|
1161 | n/a | s_strip() |
---|
1162 | n/a | |
---|
1163 | n/a | @bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000) |
---|
1164 | n/a | def terminal_newline_strip_both(STR): |
---|
1165 | n/a | s = STR("\nHello!\n") |
---|
1166 | n/a | s_strip = s.strip |
---|
1167 | n/a | for x in _RANGE_1000: |
---|
1168 | n/a | s_strip() |
---|
1169 | n/a | |
---|
1170 | n/a | @bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000) |
---|
1171 | n/a | def terminal_newline_lstrip(STR): |
---|
1172 | n/a | s = STR("\nHello!") |
---|
1173 | n/a | s_lstrip = s.lstrip |
---|
1174 | n/a | for x in _RANGE_1000: |
---|
1175 | n/a | s_lstrip() |
---|
1176 | n/a | |
---|
1177 | n/a | @bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s', |
---|
1178 | n/a | 'strip terminal newline', 1000) |
---|
1179 | n/a | def terminal_newline_if_else(STR): |
---|
1180 | n/a | s = STR("Hello!\n") |
---|
1181 | n/a | NL = STR("\n") |
---|
1182 | n/a | for x in _RANGE_1000: |
---|
1183 | n/a | s[:-1] if (s[-1] == NL) else s |
---|
1184 | n/a | |
---|
1185 | n/a | |
---|
1186 | n/a | # Strip multiple spaces or tabs |
---|
1187 | n/a | |
---|
1188 | n/a | @bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000) |
---|
1189 | n/a | def terminal_space_strip(STR): |
---|
1190 | n/a | s = STR("Hello\t \t!") |
---|
1191 | n/a | s_strip = s.strip |
---|
1192 | n/a | for x in _RANGE_1000: |
---|
1193 | n/a | s_strip() |
---|
1194 | n/a | |
---|
1195 | n/a | @bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000) |
---|
1196 | n/a | def terminal_space_rstrip(STR): |
---|
1197 | n/a | s = STR("Hello!\t \t") |
---|
1198 | n/a | s_rstrip = s.rstrip |
---|
1199 | n/a | for x in _RANGE_1000: |
---|
1200 | n/a | s_rstrip() |
---|
1201 | n/a | |
---|
1202 | n/a | @bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000) |
---|
1203 | n/a | def terminal_space_lstrip(STR): |
---|
1204 | n/a | s = STR("\t \tHello!") |
---|
1205 | n/a | s_lstrip = s.lstrip |
---|
1206 | n/a | for x in _RANGE_1000: |
---|
1207 | n/a | s_lstrip() |
---|
1208 | n/a | |
---|
1209 | n/a | |
---|
1210 | n/a | #### replace |
---|
1211 | n/a | @bench('"This is a test".replace(" ", "\\t")', 'replace single character', |
---|
1212 | n/a | 1000) |
---|
1213 | n/a | def replace_single_character(STR): |
---|
1214 | n/a | s = STR("This is a test!") |
---|
1215 | n/a | from_str = STR(" ") |
---|
1216 | n/a | to_str = STR("\t") |
---|
1217 | n/a | s_replace = s.replace |
---|
1218 | n/a | for x in _RANGE_1000: |
---|
1219 | n/a | s_replace(from_str, to_str) |
---|
1220 | n/a | |
---|
1221 | n/a | @uses_re |
---|
1222 | n/a | @bench('re.sub(" ", "\\t", "This is a test"', 'replace single character', |
---|
1223 | n/a | 1000) |
---|
1224 | n/a | def replace_single_character_re(STR): |
---|
1225 | n/a | s = STR("This is a test!") |
---|
1226 | n/a | pat = re.compile(STR(" ")) |
---|
1227 | n/a | to_str = STR("\t") |
---|
1228 | n/a | pat_sub = pat.sub |
---|
1229 | n/a | for x in _RANGE_1000: |
---|
1230 | n/a | pat_sub(to_str, s) |
---|
1231 | n/a | |
---|
1232 | n/a | @bench('"...text.with.2000.lines...replace("\\n", " ")', |
---|
1233 | n/a | 'replace single character, big string', 10) |
---|
1234 | n/a | def replace_single_character_big(STR): |
---|
1235 | n/a | s = _get_2000_lines(STR) |
---|
1236 | n/a | from_str = STR("\n") |
---|
1237 | n/a | to_str = STR(" ") |
---|
1238 | n/a | s_replace = s.replace |
---|
1239 | n/a | for x in _RANGE_10: |
---|
1240 | n/a | s_replace(from_str, to_str) |
---|
1241 | n/a | |
---|
1242 | n/a | @uses_re |
---|
1243 | n/a | @bench('re.sub("\\n", " ", "...text.with.2000.lines...")', |
---|
1244 | n/a | 'replace single character, big string', 10) |
---|
1245 | n/a | def replace_single_character_big_re(STR): |
---|
1246 | n/a | s = _get_2000_lines(STR) |
---|
1247 | n/a | pat = re.compile(STR("\n")) |
---|
1248 | n/a | to_str = STR(" ") |
---|
1249 | n/a | pat_sub = pat.sub |
---|
1250 | n/a | for x in _RANGE_10: |
---|
1251 | n/a | pat_sub(to_str, s) |
---|
1252 | n/a | |
---|
1253 | n/a | |
---|
1254 | n/a | @bench('dna.replace("ATC", "ATT")', |
---|
1255 | n/a | 'replace multiple characters, dna', 10) |
---|
1256 | n/a | def replace_multiple_characters_dna(STR): |
---|
1257 | n/a | seq = _get_dna(STR) |
---|
1258 | n/a | from_str = STR("ATC") |
---|
1259 | n/a | to_str = STR("ATT") |
---|
1260 | n/a | seq_replace = seq.replace |
---|
1261 | n/a | for x in _RANGE_10: |
---|
1262 | n/a | seq_replace(from_str, to_str) |
---|
1263 | n/a | |
---|
1264 | n/a | # This increases the character count |
---|
1265 | n/a | @bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")', |
---|
1266 | n/a | 'replace and expand multiple characters, big string', 10) |
---|
1267 | n/a | def replace_multiple_character_big(STR): |
---|
1268 | n/a | s = _get_2000_lines(STR) |
---|
1269 | n/a | from_str = STR("\n") |
---|
1270 | n/a | to_str = STR("\r\n") |
---|
1271 | n/a | s_replace = s.replace |
---|
1272 | n/a | for x in _RANGE_10: |
---|
1273 | n/a | s_replace(from_str, to_str) |
---|
1274 | n/a | |
---|
1275 | n/a | |
---|
1276 | n/a | # This decreases the character count |
---|
1277 | n/a | @bench('"When shall we three meet again?".replace("ee", "")', |
---|
1278 | n/a | 'replace/remove multiple characters', 1000) |
---|
1279 | n/a | def replace_multiple_character_remove(STR): |
---|
1280 | n/a | s = STR("When shall we three meet again?") |
---|
1281 | n/a | from_str = STR("ee") |
---|
1282 | n/a | to_str = STR("") |
---|
1283 | n/a | s_replace = s.replace |
---|
1284 | n/a | for x in _RANGE_1000: |
---|
1285 | n/a | s_replace(from_str, to_str) |
---|
1286 | n/a | |
---|
1287 | n/a | |
---|
1288 | n/a | big_s = "A" + ("Z"*128*1024) |
---|
1289 | n/a | big_s_bytes = bytes_from_str(big_s) |
---|
1290 | n/a | big_s_unicode = unicode_from_str(big_s) |
---|
1291 | n/a | def _get_big_s(STR): |
---|
1292 | n/a | if STR is UNICODE: return big_s_unicode |
---|
1293 | n/a | if STR is BYTES: return big_s_bytes |
---|
1294 | n/a | raise AssertionError |
---|
1295 | n/a | |
---|
1296 | n/a | # The older replace implementation counted all matches in |
---|
1297 | n/a | # the string even when it only needed to make one replacement. |
---|
1298 | n/a | @bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)', |
---|
1299 | n/a | 'quick replace single character match', 10) |
---|
1300 | n/a | def quick_replace_single_match(STR): |
---|
1301 | n/a | s = _get_big_s(STR) |
---|
1302 | n/a | from_str = STR("A") |
---|
1303 | n/a | to_str = STR("BB") |
---|
1304 | n/a | s_replace = s.replace |
---|
1305 | n/a | for x in _RANGE_10: |
---|
1306 | n/a | s_replace(from_str, to_str, 1) |
---|
1307 | n/a | |
---|
1308 | n/a | @bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)', |
---|
1309 | n/a | 'quick replace multiple character match', 10) |
---|
1310 | n/a | def quick_replace_multiple_match(STR): |
---|
1311 | n/a | s = _get_big_s(STR) |
---|
1312 | n/a | from_str = STR("AZZ") |
---|
1313 | n/a | to_str = STR("BBZZ") |
---|
1314 | n/a | s_replace = s.replace |
---|
1315 | n/a | for x in _RANGE_10: |
---|
1316 | n/a | s_replace(from_str, to_str, 1) |
---|
1317 | n/a | |
---|
1318 | n/a | |
---|
1319 | n/a | #### |
---|
1320 | n/a | |
---|
1321 | n/a | # CCP does a lot of this, for internationalisation of ingame messages. |
---|
1322 | n/a | _format = "The %(thing)s is %(place)s the %(location)s." |
---|
1323 | n/a | _format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", } |
---|
1324 | n/a | _format_bytes = bytes_from_str(_format) |
---|
1325 | n/a | _format_unicode = unicode_from_str(_format) |
---|
1326 | n/a | _format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items()) |
---|
1327 | n/a | _format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items()) |
---|
1328 | n/a | |
---|
1329 | n/a | def _get_format(STR): |
---|
1330 | n/a | if STR is UNICODE: |
---|
1331 | n/a | return _format_unicode |
---|
1332 | n/a | if STR is BYTES: |
---|
1333 | n/a | if sys.version_info >= (3,): |
---|
1334 | n/a | raise UnsupportedType |
---|
1335 | n/a | return _format_bytes |
---|
1336 | n/a | raise AssertionError |
---|
1337 | n/a | |
---|
1338 | n/a | def _get_format_dict(STR): |
---|
1339 | n/a | if STR is UNICODE: |
---|
1340 | n/a | return _format_dict_unicode |
---|
1341 | n/a | if STR is BYTES: |
---|
1342 | n/a | if sys.version_info >= (3,): |
---|
1343 | n/a | raise UnsupportedType |
---|
1344 | n/a | return _format_dict_bytes |
---|
1345 | n/a | raise AssertionError |
---|
1346 | n/a | |
---|
1347 | n/a | # Formatting. |
---|
1348 | n/a | @bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}', |
---|
1349 | n/a | 'formatting a string type with a dict', 1000) |
---|
1350 | n/a | def format_with_dict(STR): |
---|
1351 | n/a | s = _get_format(STR) |
---|
1352 | n/a | d = _get_format_dict(STR) |
---|
1353 | n/a | for x in _RANGE_1000: |
---|
1354 | n/a | s % d |
---|
1355 | n/a | |
---|
1356 | n/a | |
---|
1357 | n/a | #### Upper- and lower- case conversion |
---|
1358 | n/a | |
---|
1359 | n/a | @bench('("Where in the world is Carmen San Deigo?"*10).lower()', |
---|
1360 | n/a | "case conversion -- rare", 1000) |
---|
1361 | n/a | def lower_conversion_rare(STR): |
---|
1362 | n/a | s = STR("Where in the world is Carmen San Deigo?"*10) |
---|
1363 | n/a | s_lower = s.lower |
---|
1364 | n/a | for x in _RANGE_1000: |
---|
1365 | n/a | s_lower() |
---|
1366 | n/a | |
---|
1367 | n/a | @bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()', |
---|
1368 | n/a | "case conversion -- dense", 1000) |
---|
1369 | n/a | def lower_conversion_dense(STR): |
---|
1370 | n/a | s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10) |
---|
1371 | n/a | s_lower = s.lower |
---|
1372 | n/a | for x in _RANGE_1000: |
---|
1373 | n/a | s_lower() |
---|
1374 | n/a | |
---|
1375 | n/a | |
---|
1376 | n/a | @bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()', |
---|
1377 | n/a | "case conversion -- rare", 1000) |
---|
1378 | n/a | def upper_conversion_rare(STR): |
---|
1379 | n/a | s = STR("Where in the world is Carmen San Deigo?"*10) |
---|
1380 | n/a | s_upper = s.upper |
---|
1381 | n/a | for x in _RANGE_1000: |
---|
1382 | n/a | s_upper() |
---|
1383 | n/a | |
---|
1384 | n/a | @bench('("where in the world is carmen san deigo?"*10).upper()', |
---|
1385 | n/a | "case conversion -- dense", 1000) |
---|
1386 | n/a | def upper_conversion_dense(STR): |
---|
1387 | n/a | s = STR("where in the world is carmen san deigo?"*10) |
---|
1388 | n/a | s_upper = s.upper |
---|
1389 | n/a | for x in _RANGE_1000: |
---|
1390 | n/a | s_upper() |
---|
1391 | n/a | |
---|
1392 | n/a | |
---|
1393 | n/a | # end of benchmarks |
---|
1394 | n/a | |
---|
1395 | n/a | ################# |
---|
1396 | n/a | |
---|
1397 | n/a | class BenchTimer(timeit.Timer): |
---|
1398 | n/a | def best(self, repeat=1): |
---|
1399 | n/a | for i in range(1, 10): |
---|
1400 | n/a | number = 10**i |
---|
1401 | n/a | x = self.timeit(number) |
---|
1402 | n/a | if x > 0.02: |
---|
1403 | n/a | break |
---|
1404 | n/a | times = [x] |
---|
1405 | n/a | for i in range(1, repeat): |
---|
1406 | n/a | times.append(self.timeit(number)) |
---|
1407 | n/a | return min(times) / number |
---|
1408 | n/a | |
---|
1409 | n/a | def main(): |
---|
1410 | n/a | (options, test_names) = parser.parse_args() |
---|
1411 | n/a | if options.bytes_only and options.unicode_only: |
---|
1412 | n/a | raise SystemExit("Only one of --8-bit and --unicode are allowed") |
---|
1413 | n/a | |
---|
1414 | n/a | bench_functions = [] |
---|
1415 | n/a | for (k,v) in globals().items(): |
---|
1416 | n/a | if hasattr(v, "is_bench"): |
---|
1417 | n/a | if test_names: |
---|
1418 | n/a | for name in test_names: |
---|
1419 | n/a | if name in v.group: |
---|
1420 | n/a | break |
---|
1421 | n/a | else: |
---|
1422 | n/a | # Not selected, ignore |
---|
1423 | n/a | continue |
---|
1424 | n/a | if options.skip_re and hasattr(v, "uses_re"): |
---|
1425 | n/a | continue |
---|
1426 | n/a | |
---|
1427 | n/a | bench_functions.append( (v.group, k, v) ) |
---|
1428 | n/a | bench_functions.sort() |
---|
1429 | n/a | |
---|
1430 | n/a | p("bytes\tunicode") |
---|
1431 | n/a | p("(in ms)\t(in ms)\t%\tcomment") |
---|
1432 | n/a | |
---|
1433 | n/a | bytes_total = uni_total = 0.0 |
---|
1434 | n/a | |
---|
1435 | n/a | for title, group in itertools.groupby(bench_functions, |
---|
1436 | n/a | operator.itemgetter(0)): |
---|
1437 | n/a | # Flush buffer before each group |
---|
1438 | n/a | sys.stdout.flush() |
---|
1439 | n/a | p("="*10, title) |
---|
1440 | n/a | for (_, k, v) in group: |
---|
1441 | n/a | if hasattr(v, "is_bench"): |
---|
1442 | n/a | bytes_time = 0.0 |
---|
1443 | n/a | bytes_time_s = " - " |
---|
1444 | n/a | if not options.unicode_only: |
---|
1445 | n/a | try: |
---|
1446 | n/a | bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,), |
---|
1447 | n/a | "import __main__").best(REPEAT) |
---|
1448 | n/a | bytes_time_s = "%.2f" % (1000 * bytes_time) |
---|
1449 | n/a | bytes_total += bytes_time |
---|
1450 | n/a | except UnsupportedType: |
---|
1451 | n/a | bytes_time_s = "N/A" |
---|
1452 | n/a | uni_time = 0.0 |
---|
1453 | n/a | uni_time_s = " - " |
---|
1454 | n/a | if not options.bytes_only: |
---|
1455 | n/a | try: |
---|
1456 | n/a | uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,), |
---|
1457 | n/a | "import __main__").best(REPEAT) |
---|
1458 | n/a | uni_time_s = "%.2f" % (1000 * uni_time) |
---|
1459 | n/a | uni_total += uni_time |
---|
1460 | n/a | except UnsupportedType: |
---|
1461 | n/a | uni_time_s = "N/A" |
---|
1462 | n/a | try: |
---|
1463 | n/a | average = bytes_time/uni_time |
---|
1464 | n/a | except (TypeError, ZeroDivisionError): |
---|
1465 | n/a | average = 0.0 |
---|
1466 | n/a | p("%s\t%s\t%.1f\t%s (*%d)" % ( |
---|
1467 | n/a | bytes_time_s, uni_time_s, 100.*average, |
---|
1468 | n/a | v.comment, v.repeat_count)) |
---|
1469 | n/a | |
---|
1470 | n/a | if bytes_total == uni_total == 0.0: |
---|
1471 | n/a | p("That was zippy!") |
---|
1472 | n/a | else: |
---|
1473 | n/a | try: |
---|
1474 | n/a | ratio = bytes_total/uni_total |
---|
1475 | n/a | except ZeroDivisionError: |
---|
1476 | n/a | ratio = 0.0 |
---|
1477 | n/a | p("%.2f\t%.2f\t%.1f\t%s" % ( |
---|
1478 | n/a | 1000*bytes_total, 1000*uni_total, 100.*ratio, |
---|
1479 | n/a | "TOTAL")) |
---|
1480 | n/a | |
---|
1481 | n/a | if __name__ == "__main__": |
---|
1482 | n/a | main() |
---|